Want to create interactive content? It’s easy in Genially!

Get started free

Crime Scene Escape Room- Clue

Jennifer Jennings

Created on October 3, 2025

Start designing with a free template

Discover more than 1500 professional designs like these:

Chaotic Kitchen Escape Game

Farm escape room

Christmas Escape Room

Horror Escape Room

Desert Island Escape

Halloween escape

Adventure Breakout

Transcript

Crime Scene Escape Room

Help Solve the Case

start

Introduction

Welcome to the Crime Scene Escape Room

Someone murdered Professor Apple in their home. Help crime scene investigators solve the crime using your knowledge DNA fingerprinting.

Clues

Solve each clue: there is no other way to escape!

Clue 1

Clue 2

Clue 3

00:30

Use the restriction enzyme, EcoR1 to cut the sequence: GGAATTCCTTTCGGAATTCCATACG How many fragments will be produced?

four

DNA fingerprints can be produced by cutting DNA at specific locations to produce DNA fragments. Collectively these fragments represent a unique pattern. EcoR1 is a restriction enzyme that recognizes the the sequence: GAATTC. It cuts between G and A (G/AATTC).

three

two

Clues

Solve each clue: there is no other way to escape!

Clue 2

Clue 1

Clue 3

00:30

Use the restriction enzyme, EcoR1 to cut the sequence below: GGAATTCCTTTCGGAATTCCATACG Count each letter to determine the size of the second fragment?

twelve

EcoR1 is a restriction enzyme that recognizes the the sequence: GAATTC. It cuts between G and A (G/AATTC).

two

nine

Clues

Solve each Clue: there is no other way to escape!

Clue 1

Clue 2

Clue 3

01:00

Take a good look at this image:Cut the DNA fragments for each suspect with EcoR1. Which suspect left genetic material at the crime scene? Suspect 1 ACGAGTTCCCCGAATTCAACTGAATTC Suspect 2 GGGAATTCATACGAATTCTACGGAA Suspect 3 TCCCGGGATGAATTCCATACGA EcoR1 is a restriction enzyme that recognizes the the sequence: GAATTC. It cuts between G and A (G/AATTC).

Suspect 1

Suspect 2

Suspect 3

00:30

Examine the Gel Results to determine who left DNA on the broken piece of flower planter. This was overlooked by the team and contains DNA that does not belong to the victim.

Alice

Chloe

Sara

Completed

Congratulations, you have successfully solved the crime!

Start over?

Oh oh!

That answer is not correct...

But don't lose your balance, continue on your way and try again!

back

Next

That answer is not correct... Let's Review.

Restriction Enzymes are also called molecular scissors because they work like actual scissors. Instead of cutting paper, they cut DNA. See Example Below.

Enzyme X, recognizes the sequence AAT. Whenever it sees these three letters, it holds tightly to DNA and will cut within AAT at a specific location. For Enzyme X this specific location is between the two A's.

This means if I have a DNA sequence: TGCAAT, and use Enzyme X to cut it, this one fragment will be cut into two fragments. The first fragment will be 4 letters in length and the second fragment will be 2 letters in length.

Practice Question

Let's try this question based on our understanding of Restriction Enzymes. We will use Enzyme X, which recognizes the sequence AAT and cuts between the two A's. If the Sequence, AAGGGTAATGGG is cut with Enzyme X. How many fragments will be created and what is the size of the second fragment?

1; 5

2; 5

3; 7

2; 7

Next

That answer is not correct... Let's Review.

DNA Fingerprinting similar to our physical fingerprint is a way to uniquely identify individuals based on the pattern of fragments created when our DNA is cut with a Restriction Enzyme.

Let's use Enzyme X again. Enzyme X recgonizes the sequence AAT and cuts between the two A's. The gel below shows two individuals who's DNA has been cut with Enzyme X. Lane 1 is the size marker. Lane 2 is the DNA fingerprint for Person 1 and Lane 3 the DNA fingerprint for Person 2.

1 2 3

Person 1: TGACAATCC Person 2: AATTAATT

6 5 4 3 2 1

Practice Question

Match the DNA fingerprint shown on the gel to Person 1. Enzyme X was used to create the DNA fingerprint. Enzyme X recgonizes the sequence AAT and cuts between the two A's.

Lane 1 matches to Person 1

Lane 2 matches to Person 1

Lane 3 matches to Person 1

1 2 3

Person 1: TGACAATCAAT

6 5 4 3 2 1

Oh No! Times Up! Let's Try Again

Oh No! Times Up! Let's Try Again

Oh No! Times Up! Let's Try Again

Oh No! Times Up! Let's Try Again