Crime Scene Escape Room
Help Solve the Case
start
Introduction
Welcome to the Crime Scene Escape Room
Someone murdered Professor Apple in their home. Help crime scene investigators solve the crime using your knowledge DNA fingerprinting.
Clues
Solve each clue: there is no other way to escape!
Clue 1
Clue 2
Clue 3
00:30
Use the restriction enzyme, EcoR1 to cut the sequence: GGAATTCCTTTCGGAATTCCATACG How many fragments will be produced?
four
DNA fingerprints can be produced by cutting DNA at specific locations to produce DNA fragments. Collectively these fragments represent a unique pattern. EcoR1 is a restriction enzyme that recognizes the the sequence: GAATTC. It cuts between G and A (G/AATTC).
three
two
Clues
Solve each clue: there is no other way to escape!
Clue 2
Clue 1
Clue 3
00:30
Use the restriction enzyme, EcoR1 to cut the sequence below: GGAATTCCTTTCGGAATTCCATACG Count each letter to determine the size of the second fragment?
twelve
EcoR1 is a restriction enzyme that recognizes the the sequence: GAATTC. It cuts between G and A (G/AATTC).
two
nine
Clues
Solve each Clue: there is no other way to escape!
Clue 1
Clue 2
Clue 3
01:00
Take a good look at this image:Cut the DNA fragments for each suspect with EcoR1. Which suspect left genetic material at the crime scene? Suspect 1 ACGAGTTCCCCGAATTCAACTGAATTC Suspect 2 GGGAATTCATACGAATTCTACGGAA Suspect 3 TCCCGGGATGAATTCCATACGA EcoR1 is a restriction enzyme that recognizes the the sequence: GAATTC. It cuts between G and A (G/AATTC).
Suspect 1
Suspect 2
Suspect 3
00:30
Examine the Gel Results to determine who left DNA on the broken piece of flower planter. This was overlooked by the team and contains DNA that does not belong to the victim.
Alice
Chloe
Sara
Completed
Congratulations, you have successfully solved the crime!
Start over?
Oh oh!
That answer is not correct...
But don't lose your balance, continue on your way and try again!
back
Next
That answer is not correct... Let's Review.
Restriction Enzymes are also called molecular scissors because they work like actual scissors. Instead of cutting paper, they cut DNA. See Example Below.
Enzyme X, recognizes the sequence AAT. Whenever it sees these three letters, it holds tightly to DNA and will cut within AAT at a specific location. For Enzyme X this specific location is between the two A's.
This means if I have a DNA sequence: TGCAAT, and use Enzyme X to cut it, this one fragment will be cut into two fragments. The first fragment will be 4 letters in length and the second fragment will be 2 letters in length.
Practice Question
Let's try this question based on our understanding of Restriction Enzymes. We will use Enzyme X, which recognizes the sequence AAT and cuts between the two A's. If the Sequence, AAGGGTAATGGG is cut with Enzyme X. How many fragments will be created and what is the size of the second fragment?
1; 5
2; 5
3; 7
2; 7
Next
That answer is not correct... Let's Review.
DNA Fingerprinting similar to our physical fingerprint is a way to uniquely identify individuals based on the pattern of fragments created when our DNA is cut with a Restriction Enzyme.
Let's use Enzyme X again. Enzyme X recgonizes the sequence AAT and cuts between the two A's. The gel below shows two individuals who's DNA has been cut with Enzyme X. Lane 1 is the size marker. Lane 2 is the DNA fingerprint for Person 1 and Lane 3 the DNA fingerprint for Person 2.
1 2 3
Person 1: TGACAATCC Person 2: AATTAATT
6 5 4 3 2 1
Practice Question
Match the DNA fingerprint shown on the gel to Person 1. Enzyme X was used to create the DNA fingerprint. Enzyme X recgonizes the sequence AAT and cuts between the two A's.
Lane 1 matches to Person 1
Lane 2 matches to Person 1
Lane 3 matches to Person 1
1 2 3
Person 1: TGACAATCAAT
6 5 4 3 2 1
Oh No! Times Up! Let's Try Again
Oh No! Times Up! Let's Try Again
Oh No! Times Up! Let's Try Again
Oh No! Times Up! Let's Try Again
Crime Scene Escape Room- Clue
Jennifer Jennings
Created on October 3, 2025
Start designing with a free template
Discover more than 1500 professional designs like these:
View
Halloween escape
View
Adventure Breakout
View
Team Building Mission Escape Game
View
Onboarding Escape Game
View
Flags Challenge
View
Museum Escape Room
View
Education Escape Room
Explore all templates
Transcript
Crime Scene Escape Room
Help Solve the Case
start
Introduction
Welcome to the Crime Scene Escape Room
Someone murdered Professor Apple in their home. Help crime scene investigators solve the crime using your knowledge DNA fingerprinting.
Clues
Solve each clue: there is no other way to escape!
Clue 1
Clue 2
Clue 3
00:30
Use the restriction enzyme, EcoR1 to cut the sequence: GGAATTCCTTTCGGAATTCCATACG How many fragments will be produced?
four
DNA fingerprints can be produced by cutting DNA at specific locations to produce DNA fragments. Collectively these fragments represent a unique pattern. EcoR1 is a restriction enzyme that recognizes the the sequence: GAATTC. It cuts between G and A (G/AATTC).
three
two
Clues
Solve each clue: there is no other way to escape!
Clue 2
Clue 1
Clue 3
00:30
Use the restriction enzyme, EcoR1 to cut the sequence below: GGAATTCCTTTCGGAATTCCATACG Count each letter to determine the size of the second fragment?
twelve
EcoR1 is a restriction enzyme that recognizes the the sequence: GAATTC. It cuts between G and A (G/AATTC).
two
nine
Clues
Solve each Clue: there is no other way to escape!
Clue 1
Clue 2
Clue 3
01:00
Take a good look at this image:Cut the DNA fragments for each suspect with EcoR1. Which suspect left genetic material at the crime scene? Suspect 1 ACGAGTTCCCCGAATTCAACTGAATTC Suspect 2 GGGAATTCATACGAATTCTACGGAA Suspect 3 TCCCGGGATGAATTCCATACGA EcoR1 is a restriction enzyme that recognizes the the sequence: GAATTC. It cuts between G and A (G/AATTC).
Suspect 1
Suspect 2
Suspect 3
00:30
Examine the Gel Results to determine who left DNA on the broken piece of flower planter. This was overlooked by the team and contains DNA that does not belong to the victim.
Alice
Chloe
Sara
Completed
Congratulations, you have successfully solved the crime!
Start over?
Oh oh!
That answer is not correct...
But don't lose your balance, continue on your way and try again!
back
Next
That answer is not correct... Let's Review.
Restriction Enzymes are also called molecular scissors because they work like actual scissors. Instead of cutting paper, they cut DNA. See Example Below.
Enzyme X, recognizes the sequence AAT. Whenever it sees these three letters, it holds tightly to DNA and will cut within AAT at a specific location. For Enzyme X this specific location is between the two A's.
This means if I have a DNA sequence: TGCAAT, and use Enzyme X to cut it, this one fragment will be cut into two fragments. The first fragment will be 4 letters in length and the second fragment will be 2 letters in length.
Practice Question
Let's try this question based on our understanding of Restriction Enzymes. We will use Enzyme X, which recognizes the sequence AAT and cuts between the two A's. If the Sequence, AAGGGTAATGGG is cut with Enzyme X. How many fragments will be created and what is the size of the second fragment?
1; 5
2; 5
3; 7
2; 7
Next
That answer is not correct... Let's Review.
DNA Fingerprinting similar to our physical fingerprint is a way to uniquely identify individuals based on the pattern of fragments created when our DNA is cut with a Restriction Enzyme.
Let's use Enzyme X again. Enzyme X recgonizes the sequence AAT and cuts between the two A's. The gel below shows two individuals who's DNA has been cut with Enzyme X. Lane 1 is the size marker. Lane 2 is the DNA fingerprint for Person 1 and Lane 3 the DNA fingerprint for Person 2.
1 2 3
Person 1: TGACAATCC Person 2: AATTAATT
6 5 4 3 2 1
Practice Question
Match the DNA fingerprint shown on the gel to Person 1. Enzyme X was used to create the DNA fingerprint. Enzyme X recgonizes the sequence AAT and cuts between the two A's.
Lane 1 matches to Person 1
Lane 2 matches to Person 1
Lane 3 matches to Person 1
1 2 3
Person 1: TGACAATCAAT
6 5 4 3 2 1
Oh No! Times Up! Let's Try Again
Oh No! Times Up! Let's Try Again
Oh No! Times Up! Let's Try Again
Oh No! Times Up! Let's Try Again