LS 3. Lottery or perfect combination_ How did life arise on Earth_

03

Lottery or perfect combination? How did life arise on Earth?.

Origin of life

3.1

Remember

In Spanish, "un billón" refers to "un millón de millones" (a million million) while "a billion" in modern English refers to "a thousand million". A billion (in English): 1,000,000,000 Un billón (es español): 1,000,000,000,000

Although our planet is ≈ 4.6 billion years old, life appear later, ≈ 3.8 billion years ago.

But do all scientists agree on the origin of Life?

Origin of life

3.1

Activity 1

Reading comprehension

KEY CONCEPTS Theories about the origins of life are as ancient as human culture. Greek thinkers like Anaximander thought life originated with spontaneous generation, the idea that small organisms are spontaneously generated from nonliving matter. The theory of spontaneous generation was challenged in the 18th and 19th centuries by scientists conducting experiments on the growth of microorganisms. Louis Pasteur, by conducting experiments that showed exposure to fresh air was the cause of microorganism growth, effectively disproved the spontaneous generation theory. Abiogenesis, the theory that life evolved from nonliving chemical systems, replaced spontaneous generation as the leading theory for the origin of life. Haldane and Oparin theorized that a "soup" of organic molecules on ancient Earth was the source of life's building blocks. Experiments by Miller and Urey showed that likely conditions on early Earth could create the needed organic molecules for life to appear. RNA, and through evolutionary processes, DNA and the diversity of life as we know it, likely formed due to chemical reactions among the organic compounds in the "soup" of early Earth.

Image example about how to share your task

3.1.1

The prebiotic synthesis.

After Pasteur's compelling experiences, the problem of the origin of life took more than sixty years to be addressed again. In the 1920s, the Russian biochemist Alexander Oparin and the British geneticist J.B.S Haldane independently devised a revolutionary proposal; a new version of spontaneous generation but applicable only at the beginning of life. According to Oparin and Haldane, life would be the result of a gradual process that included three stages. The first two stages constitute the so-called prebiotic synthesis:

What evidences do we have nowadays that inorganic molecules can turn into organic compounds using energy?

the components of the primitive atmosphere, exposed to strong solar radiation and electrical discharges, would react to create organic molecules such as amino acids.

01. Formation of simple molecules:

Simple organic molecules would combine to form more complex ones, which would accumulate in the primitive oceans, giving rise to the "primordial soup."

some of the compounds in this primordial soup would join together, creating hollow spheres or coacervates. Molecules, such as nucleic acids, that could make copies of themselves would be enclosed inside these coacervates. They would be, consequently, the precursors of the first organisms.

02

Título aquí

02. Formation of complex organic molecules:

04

Título aquí

03. Formation of coacervates:

3.1.1

Testing the Oparin-Haldane hypothesis

The Oparin-Hladane hypothesis received strong support in 1953 thanks to the experiment carried out by Stanley Miller and Harold Urey, in which they reproduced in the laboratory the conditions that were supposed to exist on the primitive Earth and he managed to form simple organic compounds.

Activity 2

Summarize the experiment in your notebook. -Objective of the experiment and steps.

Título aquí

3.1.2

What is The Cell Theory?

3. Activity

• Watch the video.
• Summarize the cell theory on your notebook (individually)
• In pairs.

• Create a timeline with the most important events (include dates and names) that led to propose the Cell theory.
• Explain why these events led to propose the Cell Theory.

3.2

Evolution theories

Until the 19th century, biodiversity was explained by fixist theories, which held that species remained unchanged since they appeared. From the 19th century, evolutionary theories began to make their way. In chronological order:

Teacher

Activity 4 Comparing the theories (new version)

Activity 4 Compare and contrast the 3 theories

Teacher

Darwinism

Neodarwinism

Lamarckism

Activity 5 Natural Selection

‘Nothing in Biology makes sense except in the light of evolution’ Theodosius Dobzhansky

Who is Lynn Margulis?

Teacher

Source: Wikipedia

3.2

Evolution: the origin of biodiversity.

Biodiversity is the result of millions of years of evolution, since the beginning of life on Earth. Organisms change, develop adaptations: new characteristics (morphological, physiological and behavioral) that increase their survival options in a specific environment and constitute the evolutionary process. There is strong evidence for characteristics of species changing over time.

Remember

Biodiversity or biological diversity refers to the enormous variability that exists between the living beings that make up the biosphere (the Earth): it includes both the genetic diversity within each species and the diversity of species and the diversity of ecosystems.

What are these evidences?

3.2

Evidences of evolution.

1. Fossil records.

2. Homologous, analogous and vestigial structures.

3. Biogeographical evidences.

4. Embryological evidences.

5.Molecular evidences.

Evidences of evolution.

3.2

1. Fossil records.

There has been a huge amount of research into fossils, which is the branch of science called paleontology. It has given us strong evidence that evolution has occurred. Studying fossils can provide evidence of how organism evolved from one another and so how closely related they are. This is the part of phylogeny. Example Fossils of Archaeopteryx (a reptile with feathers that enabled it to fly) provide evidence that birds evolved from dinosaurs.

Evidences of evolution.

3.2

1. Fossil records.

Fossil records.

• The sequence in which fossils appear matches the sequence in which they would be expected to evolve.

Bacteria and algae 3.5 billion years ago

Bony fish 420 million years ago (mya)

Fist fungi and worms 1 billion years ago

Placental mammals 110 mya

Birds 250 mya

Amphibians 340 mya

Reptiles 320 mya

• The sequence also fits in with the ecology of the groups, with plant fossils appearing before animal. Plants on land before animals on land, and plants suitable for insect pollination before insect pollination.

3.2

1. Fossil records.

• Many sequences of fossils are known, which link together existing organisms with their likely ancestors. For example, horses, donkeys and zebras, members of the genus Equus, are most closely related to rhinoceroses and tapirs. An extensive sequence of fossils, extending bach over 60 million years, links them to Hyracotherium, an animal very similar to a rhinoceros.

Source: Solounias et al (https://doi.org/10.1098/rsos.171782) (CC BY 4.0)

3.2

Evidences of evolution.

2. Homologous, analogous and vestigial structures.

Evidences of evolution.

3.2

2. Homologous, analogous and vestigial structures.

Homologous organs Homologous organs are similar in structure and share a common origin but may be adapted to perform different functions. One example of homology is the case of the limbs of mammals.

Analogous organs Analogous organs are those that have evolved separately but look alike because they are adapted to perform the same function. One example of analogous organs is the case of the wings of insects and birds.

Evidences of evolution.

3.2

2. Homologous, analogous and vestigial structures.

Vestigial organs Vestigial organs are those organs, found in some living things, that do not perform any functions. They simply show an evolutionary relationship with other living things. One example of a vestigial organ is the coccyx, or tailbone, in humans. The coccyx is the remnant of a lost tail.

3.2

Evidences of evolution.

3. Biogeographical evidences.

The geographic distribution of species is explained by the sum of evolutionary processes and plate tectonics throughout the history of the Earth. The breakup of the Pangea supercontinent caused the isolation of many groups in different countries, in which they evolved by adapting to local conditions. An obvious case of relationship between evolution and geography are the endemisms of the islands.

The distribution of fossils across the continents is one line of evidence pointing to the existence of Pangaea. Source: Wikiwand.com

3.2

Evidences of evolution.

5. Embryological evidences.

Gathering embryological evidence involves looking at the similarities in the early stages of an organism’s development.

Fish and salamander embryos are more similar than turle and salamander embryos. This suggests that salamaders are more closely related to fish than to turtles.

3.3

Speciation

Speciation is the formation of new species from an existing population. New species appear as a result of the population of a single species splitting into two or more new ones. Speciation is said to be sympatric or allopatric. • Allopatric speciation occurs in different geographical areas. • Sympatric speciation: occurs in the same geographical area, as a consequence of reproductive isolation. Speciation can only occur if there is a barrier dividing the population.

Evidences of evolution.

3.2

4.Molecular evidences.

Gathering molecular evidence involves analyzing the similarities in proteins and DNA. More closely related organism will have more similar molecules. You can compare things like how DNA is stored, the sequence of DNA bases and the sequence of amino acids in proteins form different organisms.

The diagram below shows the DNA base sequence for gene X in three sifferent species: Species A: ATTGTCTGATTGGTGCTAGTCGTCGATGCTAGGATCG Species B: ATTGTATGATTGGTGCTAGTCGGCGATGCTAGGATCG Species C: ATTGATTGAAAGGAGCTACTCGTAGATATAAGGAGGT There are 13 differences between the base sequence in sppecies A and C, but only 2 differenties between the base sequences in species A and B. This suggests that species A and B are more closely related than A and C.

ACTIVITY 6

Missing organism

Teacher (pendiente)

3.3

Speciation

ACTIVITY 7

3.3

Speciation

There are two main categories of reproductive isolation barriers:

• Pre-zygotic isolation - occurs before fertilisation (no offspring is produced)
• Post-zygotic isolation - occurs after fertilisation (offspring is either not viable or infertile)

Teacher

Pre-zygotic mechanisms

Temporal isolation

Occurs when two species mate or flower at different times of the year.

Ecological isolation

Occurs when two species inhabit similar regions, but occupy different habitats.

Behavioural isolation

Occurs when two species respond to different specific courtship patterns.

Mechanical isolation

Occurs when genital differences prevent copulation (animals) or when flowers are pollinated by different animals (plants)

Post-zygotic isolation mechanisms

hybrid inviability

Hybrids are produced but fail to develop to reproductive maturity.

hybrid infertility

Hybrids fail to produce functional gametes.

hybrid breakdown

The F1 hybrids are fertile but the F2 generation fail to develop or are infertile